Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_103736 | |||
Gene | LARP1B | Organism | Human |
Genome Locus | chr4:128995614-128996148:n/a | Build | hg19 |
Disease | Cutaneous Squamous Cell Carcinoma | ICD-10 | Cervix uteri, unspecified (C53.9) |
DBLink | Link to database | PMID | 27298156 |
Experimental Method | |||
Sample Type | Skin Tissues | Comparison | People who suffered from six Cutaneous Squamous Cell Carcinoma (cSCC) and six non-lesional skin (control) biopsiesCSCC and healthy individuals |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward GCTAGTGATTTCAGTGATATGGAG ReverseGTTGGATTTCTTTGTCTTGAGC | Statistics | Fold Change : Upregulated pvalue : p=0.009 |
Citation | |||
Sand, M, Bechara, FG, Gambichler, T, Sand, D, Bromba, M, Hahn, SA, Stockfleth, E, Hessam, S (2016). Circular RNA expression in cutaneous squamous cell carcinoma. J. Dermatol. Sci., 83, 3:210-8. |